Защитное действие традиционной японской медицины Hainosankyuto на инфекцию Streptococcus pyogenes на мышиной модели

  1. Аннотация Фон
  2. Методология / Основные выводы
  3. Выводы / Значение
  4. Вступление
  5. Результаты
  6. Модель мышиной инфекции
  7. Бактерицидные анализы крови
  8. Анализ сывороточных цитокинов при заражении
  9. Влияние Хайносанкюто на фагоцитарную активность
  10. Экспрессия цитокинов перотинного макрофага у мышей, получавших Hainosankyuto
  11. обсуждение
  12. Материалы и методы
  13. Соединение
  14. Тестирование чувствительности
  15. Мышиная модель инвазивной инфекции кожи и мягких тканей
  16. Бактерицидный анализ крови
  17. Анализ сывороточных цитокинов при заражении
  18. Макрофагальные клетки
  19. Анализ макрофагов на фагоциты
  20. Нозерн-блоттинг анализ
  21. Количественная RT-PCR в явном времени
  22. статистический анализ
  23. Подтверждения
  24. Вклад автора

Аннотация

Фон

Streptococcus pyogenes ( S. pyogenes ) вызывает различные серьезные заболевания, включая некротический фасциит и синдром стрептококкового токсического шока. Одной из серьезных проблем, наблюдаемых в последнее время при терапии S. pyogenes, является ослабление антибиотического эффекта, особенно неудачи лечения пенициллином и устойчивости к макролидам. Hainosankyuto, традиционная японская медицина, основанная на древней китайской медицине, использовалась для лечения инфекционных гнойных заболеваний в Японии. В этом исследовании мы исследовали защитную и терапевтическую эффективность Hainosankyuto против инфекции S. pyogenes -skin.

Методология / Основные выводы

Метод микродилюции бульона показал, что Hainosankyuto не проявлял прямого антибактериального эффекта против S. pyogenes . Принудительное кормление Hainosankyuto для инфицированных мышей в течение 4 дней подряд увеличивало выживаемость и уменьшало размер локальных поражений кожи по сравнению с мышами, получавшими PBS. Хотя мы не обнаружили значительного восстановления выживаемости при введении Hainosankyuto только после заражения S. pyogenes , размеры язвенного поражения были значительно меньше после введения Hainosankyuto по сравнению с мышами, получавшими PBS. Не было обнаружено различий в антибактериальном эффекте Hainosankyuto между восприимчивыми к макролидам и устойчивыми штаммами. Бактерицидный анализ крови показал, что выживаемость S. pyogenes при использовании крови мышей, обработанных Hainosankyuto, была ниже, чем при использовании крови необработанных мышей. Мы также обнаружили увеличение уровней IL-12, IFN-γ и снижение уровня TNF-α в сыворотке мышей, инфицированных S. pyogenes, получавших Hainosankyuto. Перитонеальный макрофаг мыши от мышей, обработанных Hainosankyuto, обладал значительной фагоцитарной активностью и повышал уровни мРНК IL-12, IFN-γ и снижал уровень мРНК TNF-α по сравнению с контрольным макрофагом.

Выводы / Значение

Hainosankyuto увеличил выживаемость после заражения S. pyogenes и усилил бактерицидную активность крови и фагоцитарную активность макрофагов посредством модуляции воспалительных цитокинов. Наши данные также свидетельствуют о том, что Hainosankyuto может быть полезен для лечения инфекции S. pyogenes более профилактически, чем терапевтически.

Образец цитирования: Минами М., Итикава М., Хата Н., Хасегава Т. (2011) Защитное действие традиционной японской медицины Хайносанкюто на инфекцию Streptococcus pyogenes на мышиной модели. PLOS ONE 6 (7): e22188. https://doi.org/10.1371/journal.pone.0022188

Редактор: Т. Марк Доэрти, Институт Statens Serum, Дания

Получено: 28 января 2011 г .; Принят: 19 июня 2011 г .; Опубликовано: 22 июля 2011 г.

Авторское право: © 2011 Minami et al. Это статья с открытым доступом, распространяемая в соответствии с условиями лицензии Creative Commons «Attribution», которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии, что первоначальный автор и источник предоставлены.

Финансирование: Это исследование было поддержано грантом на исследования в университете города Нагоя и исследовательским фондом Ассоциации Тойо Игаку Кенкью. Спонсоры не участвовали в разработке исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Конкурирующие интересы: авторы заявили, что не существует конкурирующих интересов.

Вступление

Грамположительная бактерия Streptococcus pyogenes ( S. pyogenes ) является наиболее распространенным агентом, вызывающим инфекции верхних дыхательных путей и кожи [1] , Он также ответственен за постстрептококковые заболевания, такие как ревматизм и гломерулонефрит, в дополнение к увеличению частоты инвазивных инфекций, таких как синдром стрептококкового токсического шока. [1] ,

Одна серьезная проблема с терапией S. pyogenes - ослабление антибиотического эффекта. Несмотря на то, что S. pyogenes всегда чувствителен к пенициллину, S. pyogenes поражает до 20% пациентов, получавших пенициллин, и половина из этих случаев также является клинической неудачей [2] , В последние годы устойчивые к макролиду и линкозамиду изоляты S. pyogenes постепенно распространились по всему миру. [3] , Новые антимикробные агенты, кроме антибиотиков, в настоящее время находятся в поиске.

Традиционные растительные лекарственные средства подвергаются переоценке в клинической области из-за их относительно небольшого количества побочных эффектов и пригодности для длительного применения по сравнению с синтетическими лекарственными средствами. В последнее время несколько видов этих травяных лекарств были использованы клинически при различных заболеваниях в Японии. [4] , Предыдущие сообщения описывали биологическое действие растительных лекарственных средств на иммунные реакции при бактериальной инфекции. [5] , Сообщается об исследованиях фитотерапии, определяющих роль энтомопатогенного гриба Cordyceps sinensis ( C. sinensis ) в анти- S. pyogenes терапии. [6] , Продукция цитокинов, таких как интерлейкин (IL) -12, интерферон (IFN) -γ и фактор некроза опухолей (TNF) -α, и активация фагоцитарной активности фракцией C. sinensis могут играть роль в противоопухолевой и противоопухолевой терапии. бактериальная деятельность.

Hainosankyuto, традиционная травяная японская медицина, основанная на древней китайской медицине, использовалась для лечения инфекционных гнойных заболеваний, и было предложено иметь различные функции. Однако до настоящего времени Хайносанкюто не был исследован на предмет его роли в антибактериальной терапии.

В настоящем исследовании мы оценили защитную эффективность Hainosankyuto против S. pyogenes, используя модель мышиной инфекции кожи. Мы предварительно обработали мышей ICR Hainosankyuto или PBS и вводили Hainosankyuto или PBS после заражения S. pyogenes в течение 2 дней. Затем мы исследовали уровни цитокинов в сыворотке, бактерицидную активность крови и смертность у обеих групп мышей каждый день. Кроме того, мы также оценили терапевтический эффект Hainosankyuto против инфекции S. pyogenes и фагоцитарную активность макрофага мышей, обработанных Hainosankyuto, как механизма защиты.

Результаты

Определение MIC

MIC Хайносанкюто был выше 256 мкг / мл. Антибактериального эффекта Хайносанкюто против S. pyogenes не наблюдалось.

Модель мышиной инфекции

В настоящем исследовании модель животного использовалась для проверки того, будет ли Hainosankyuto оказывать хозяину защитный эффект против инфекции S. pyogenes . Мышей в контрольной группе начали умирать на 2-й день после инокуляции S. pyogenes 1529, и выживаемость снизилась до 0% после 4-го дня. Мышей в группе, получавшей Hainosankyuto, начали умирать на 4-й день после инокуляции S. pyogenes 1529, и выживаемость осталась на уровне 80% после 7 дня ( Рисунок 1А ). Кроме того, мыши контрольной группы начали умирать на 2-й день после инокуляции S. pyogenes D2TY, а коэффициент выживаемости снизился до 0% после 4-го дня. Мыши в группе, получавшей Hainosankyuto, начали умирать на 5-й день после инокуляции S. pyogenes D2TY, и выживаемость осталась на уровне 60% после 7 дня ( Рисунок 1B ). Кроме того, как показано в Рисунок 2А Размер поражения на 3-й день после инъекции был меньше у мышей, получавших Hainosankyuto, которым инъецировали S. pyogenes 1529, по сравнению с контрольными мышами ( р <0,05). Размер поражения у мышей, инфицированных S. pyogenes, был измерен, и Рисунок 2B представляет значимое различие, наблюдаемое в размере поражения между обработанными Hainosankyuto и необработанными мышами ( p <0,05).

pyogenes, был измерен, и   Рисунок 2B   представляет значимое различие, наблюдаемое в размере поражения между обработанными Hainosankyuto и необработанными мышами ( p <0,05)

Рисунок 1. Профилактическое введение Hainosankyuto увеличило выживаемость мышиных моделей, зараженных S. pyogenes .

Трехнедельных мышей ICR подвергали принудительному кормлению Hainosankyuto () или PBS () в течение 4 последовательных дней (день -1, 0, 1 и 2) и инокулировали 1 × 108 КОЕ S. pyogenes 1529 ( Рисунок 1А ) и D2TY ( Рисунок 1B ) в день 0. Смертность контролировалась в течение 7 дней. Данные по выживаемости были оценены с помощью анализа выживаемости Каплана-Мейера и проверены на достоверность с использованием логарифмического критерия.

https://doi.org/10.1371/journal.pone.0022188.g001

g001

Рисунок 2. Профилактическое введение Hainosankyuto предотвратило язву на мышиной модели, зараженной S. pyogenes 1529 и D2TY.

Трехнедельных мышей ICR подкожно инокулировали 1 × 108 КОЕ S. pyogenes 1529 ( Рисунок 2А ). Мышей наблюдали ежедневно на предмет образования очага и некроза. Hainosankyuto уменьшил размер язвенных поражений на мышиной модели, зараженной S. pyogenes ( Рисунок 2B ). Размер повреждения (длина × ширина) измеряли с длиной, определяемой как самый длинный размер повреждения. Замкнутый кружок и незакрашенный кружок представлены мышами, обработанными Hainosankyuto и необработанными, соответственно. Данные о размере повреждения были проверены на значимость с использованием t- теста. *: р <0,05.

https://doi.org/10.1371/journal.pone.0022188.g002

Затем мы исследовали, полезен ли Хайносанкюто терапевтически. Мыши в группе, получавшей Hainosankyuto, начали умирать на 2-й день после инокуляции S. pyogenes 1529, и выживаемость оставалась на уровне 33% после 7-го дня ( p = 0,0589) ( Рисунок 3А ). Кроме того, мыши контрольной группы начали умирать на 2-й день после инокуляции S. pyogenes D2TY, а коэффициент выживаемости снизился до 0% после 4-го дня. Мыши в группе, получавшей Hainosankyuto, начали умирать на 2-й день после инокуляции S. pyogenes D2TY, и выживаемость оставалась на уровне 33% после 7-го дня ( р = 0,0569) ( Рисунок 3B ). Хотя показатели выживаемости в группе, получавшей Hainosankyuto, были выше, чем в контрольной группе, между этими двумя группами не было значимых различий. Однако измеряли размер повреждения у мышей, инфицированных S. pyogenes , и Рисунок 4 продемонстрировали значительную разницу, наблюдаемую в размере поражения у мышей, получавших Hainosankyuto и необработанных ( p <0,05).

Фигура 3. Терапевтическое введение Hainosankyuto имело тенденцию увеличивать выживаемость мышиных моделей, зараженных S. pyogenes .

Трехнедельных мышей ICR инокулировали 1 × 108 КОЕ S. pyogenes 1529 ( Рисунок 3А ) и D2TY ( Рисунок 3B ). Через 24 часа их принудительно кормили Hainosankyuto () или PBS () в течение 4 дней подряд (день 1, 2, 3 и 4) и. Смертность контролировалась в течение 7 дней после заражения. Данные по выживаемости были оценены с помощью анализа выживаемости Каплана-Мейера и проверены на достоверность с использованием логарифмического критерия.

https://doi.org/10.1371/journal.pone.0022188.g003

g003

Фигура 4. Терапевтическое введение Hainosankyuto предотвращало язву на мышиной модели, инфицированной S. pyogenes .

Трехнедельных мышей ICR подкожно инокулировали каждым штаммом. Мышей наблюдали ежедневно на предмет образования очага и некроза. Размер повреждения (длина × ширина) измеряли с длиной, определяемой как самый длинный размер повреждения. Замкнутый кружок и незакрашенный кружок представлены мышами, обработанными Hainosankyuto и необработанными, соответственно. Данные о размере поражения были проверены на значимость с помощью t-критерия. *: р <0,05.

https://doi.org/10.1371/journal.pone.0022188.g004

Бактерицидные анализы крови

Чтобы определить, проявляют ли лейкоциты у мышей, обработанных Hainosankyuto, повышенную бактерицидную активность, мы провели анализы уничтожения S. pyogenes с использованием крови мышей. Как показано в Рисунок 5А кровь от необработанных мышей убила приблизительно 70% бактериального инокулята после 30-минутной инкубации при 37 ° C. Подобные уровни гибели S. pyogenes наблюдались в крови мышей Balb / C (данные не представлены). Кровь от мышей, обработанных Hainosankyuto, убила приблизительно 90% инокулята S. pyogenes после 30-минутной инкубации при 37 ° C. Значительные различия наблюдались в снижении КОЕ S. pyogenes 1529 между обработанными Hainosankyuto и необработанными мышами ( p <0,05) ( Рисунок 5А ). Значительные различия наблюдались в снижении КОЕ S. pyogenes D2TY между мышами, обработанными Hainosankyuto и необработанными ( p <0,05) ( Рисунок 5В ).

pyogenes D2TY между мышами, обработанными Hainosankyuto и необработанными ( p <0,05) (   Рисунок 5В   )

Рисунок 5. Бактерицидный анализ крови на мышиной модели, зараженной S. pyogenes .

Примерно 1000 КОЕ S. pyogenes 1529 ( Рисунок 5А ) и D2TY ( Рисунок 5В ) добавляли к 1 мл цельной крови гепаринизированной 3-недельной мыши ICR и вращали при 37 ° С. Разбавленные образцы крови высевали в указанные моменты времени для определения количества КОЕ. Замкнутый кружок и незакрашенный кружок представлены мышами, обработанными Hainosankyuto и необработанными, соответственно. *: р <0,05.

https://doi.org/10.1371/journal.pone.0022188.g005

Анализ сывороточных цитокинов при заражении

Была исследована кинетика появления цитокинов, таких как IL-12, IFN-γ и TNF-α, сыворотки инфицированных мышей с обработкой Hainosankyuto или без нее. Мыши в обеих группах показали значительно повышенные уровни IL-12 в сыворотке по сравнению с уровнями до инъекции ( р <0,05) ( Рисунок 6А ). Мыши в группе, получавшей Hainosankyuto, показали значительно повышенный уровень IL-12 и IFN-γ в сыворотке по сравнению с контрольными мышами ( p <0,05) ( Рисунок 6B ). Значительное снижение уровня TNF-α наблюдалось в группе, получавшей Hainosankyuto, в 1-й день ( р <0,05) ( Рисунок 6С ). Тем не менее, в дни 0, 2 и 3 не наблюдалось значительного различия в уровне TNF-α между контрольной и зараженной группами.

Тем не менее, в дни 0, 2 и 3 не наблюдалось значительного различия в уровне TNF-α между контрольной и зараженной группами

Фигура 6. Временная зависимость уровней IL-12, IFN-γ и TNF-α в сыворотке, определенных с помощью ELISA, при S. pyogenes -инфекции.

Трехнедельным мышам ICR давали 1 г / кг массы тела Hainosankyuto или PBS перед заражением. После заражения S. pyogenes 1529 мышей умерщвляли под анестезией СО2 в надлежащее время и собирали образцы крови. Сыворотка ил-12 ( Рисунок 6А ), ИФН-γ ( Рисунок 6B ) и TNF-α ( Рисунок 6С ) были проанализированы методом ERISA. Замкнутый кружок и незакрашенный кружок представлены мышами, обработанными Hainosankyuto и необработанными, соответственно. *: р <0,05.

https://doi.org/10.1371/journal.pone.0022188.g006

Влияние Хайносанкюто на фагоцитарную активность

Затем мы сфокусировались на активности макрофагов от лейкоцитов, потому что макрофаг играет основную роль в фагоцитарной активности в модели мышиной инфекции. Чтобы определить, проявляют ли перитонеальные макрофаги у мышей, обработанных Hainosankyuto, повышенную фагоцитарную активность, мы провели анализ фагоцитов на S. pyogenes . Как показано в Рисунок 7А макрофаг от необработанных мышей убивал приблизительно 60% инокулята S. pyogenes 1529 после 30-минутной инкубации при 37 ° С. Макрофаг от мышей, обработанных Hainosankyuto, убивал более 99% инокулята S. pyogenes 1529 после 30-минутной инкубации при 37 ° C. Рисунок 7B показали, что макрофаги от необработанных мышей убивали приблизительно 90% инокулята S. pyogenes D2TY после 30-минутной инкубации при 37 ° C. Макрофаг от мышей, обработанных Hainosankyuto, убивал более 99% инокулята S. pyogenes D2TY после 30-минутной инкубации при 37 ° C. Значительные различия наблюдались как в снижении уровня S. pyogenes 1529, так и в снижении КОЕ D2TY у мышей, получавших Hainosankyuto и необработанных ( p <0,05) ( Рисунок 7А , Рисунок 7B ).

pyogenes 1529, так и в снижении КОЕ D2TY у мышей, получавших Hainosankyuto и необработанных ( p <0,05) (   Рисунок 7А   ,   Рисунок 7B   )

Рисунок 7. Анализ фагоцитов перитонеальных макрофагов мыши.

Трехнедельный перитонеальный макрофаг мыши ICR был приготовлен и определен путем смешивания клеток с S. pyogenes 1529 ( Рисунок 7А ) или D2TY ( Рисунок 7B ) при 37 ° С. Разбавленные образцы высевали в указанные моменты времени для определения количества КОЕ. Замкнутый кружок и незакрашенный кружок представлены мышами, обработанными Hainosankyuto и необработанными, соответственно. *: р <0,05.

https://doi.org/10.1371/journal.pone.0022188.g007

Экспрессия цитокинов перотинного макрофага у мышей, получавших Hainosankyuto

Мы исследовали экспрессию цитокинов, индуцированную Hainosankyuto. Группу из трех мышей ICR подвергали принудительному кормлению Hainosankyuto, а контрольным - принудительно кормили PBS. Через 24 часа перитонеальный макрофаг был извлечен у двух групп мышей и три экспрессии цитокинов были измерены с помощью анализа методом Нозерн-блоттинга ( Рисунок 8А ) и количественная ОТ-ПЦР в реальном времени ( Рисунок 8B ). Результаты показали увеличение экспрессии мРНК как IL-12, так и INF-γ в макрофагах мышей после обработки Hainosankyuto по сравнению с контролем PBS. Наоборот, уровень экспрессии мРНК TNF-α снижался в макрофагах мышей после обработки Hainosankyuto по сравнению с контролем PBS.

Наоборот, уровень экспрессии мРНК TNF-α снижался в макрофагах мышей после обработки Hainosankyuto по сравнению с контролем PBS

Фигура 8. Уровни мРНК цитокинов в перитонеальном макрофаге мыши при лечении Хайносанкюто.

Трехнедельных мышей ICR подвергали принудительному кормлению Hainosankyuto в течение 1 дня. Перитонеальный макрофаг мыши был приготовлен в виде одноклеточной суспензии. Затем тотальную РНК экстрагировали и экспрессию IL-12, IFN-γ и TNF-α определяли с помощью анализа методом северного блоттинга ( Рисунок 8А ) и количественная ОТ-ПЦР в реальном времени ( Рисунок 8B ), с HPRT в качестве внутреннего контроля.

https://doi.org/10.1371/journal.pone.0022188.g008

обсуждение

Насколько нам известно, это первое исследование анти- S. pyogenes терапии с помощью Hainosankyuto.

После заражения S. pyogenes у мышей, обработанных Hainosankyuto, наблюдалась повышенная выживаемость, бактерицидная активность в крови, сывороточные уровни воспалительных цитокинов, включая IL-12 и IFN-γ, фагоцитарная активность макрофагов и уровни мРНК макрофагов воспалительных цитокинов, включая IL-12 и IFN-. γ. Эти результаты свидетельствуют о том, что Hainosankyuto может играть важную роль в защите от S. pyogenes .

Наши данные также потенциально предполагают, что Hainosankyuto может быть полезен при лечении резистентных к клиндамицину S. pyogenes . Поскольку Hainosankyuto сам по себе не является антибиотиком и не обладает антибактериальным действием против S. pyogenes , возникновение Hainosankyuto-резистентных S. pyogenes в будущем кажется невозможным. Мы предполагаем, что Hainosankyuto может быть эффективным при использовании против новых штаммов устойчивых к антибиотикам S. pyogenes .

Мы также исследовали влияние Hainosankyuto против других изолятов S. pyogenes типа emm (M4, M12, M28 и M49) и подтвердили, что Hainosankyuto оказывал такое же ингибирующее действие на эти изоляты (данные не показаны). Ингибирование роста определенных изолятов emm- типа и эффектов Hainosankyuto может быть не связано. Наши результаты показывают, что Hainosankyuto напрямую влияет на иммунную систему хозяина в отношении инфекции S. pyogenes .

Hainosankyuto - это традиционное японское растительное лекарственное средство, впервые разработанное доктором Тодо Йошимасу, японским врачом 17-го века, путем объединения Hainoto и Hainosan, которые также являются традиционными японскими лекарствами. Тем не менее, Хайносанкюто в настоящее время популярен и широко назначается для терапии в Японии. Поскольку ни Hainoto, ни Hainosan не являются легкодоступными в продаже, мы выбрали Hainosankyuto для нашего исследования. Хотя предыдущие исследования Хайносанкюто не были найдены, одно сообщение показало противовоспалительный эффект как Хайното, так и Хайносана. [7] , Как Hainoto, так и Hainosan в зависимости от дозы ингибируют индуцированную уксусной кислотой проницаемость сосудов и каррагенин-индуцированный отек задних лап; Обе особенности ранней экссудативной стадии воспаления. Каждый отдельный компонент Хайносанкюто также проявляет противовоспалительное действие. Платикодин D от Platycodon Root оказывает противовоспалительное действие посредством регуляции пути NF-κB [8] , Глицирризин от Glycyeehiza - сладкий тритерпеноидный гликозид, обладающий противовоспалительной и противоаллергической активностью. [9] , [10] , Paeoniae radix из корня пиона оказывает противовоспалительное действие на мышь [11] , Экстракт корня имбиря, экстракт незрелого апельсина и экстракт ююбы обладают активностью, подобной супероксиддиумутазе [12] , Хотя каждый компонент обладает противовоспалительным эффектом, этот механизм в деталях неизвестен. Традиционное японское растительное лекарственное средство, как правило, состоит из нескольких компонентов, и их взаимодействие может усиливать действие лекарств. Поскольку необходимы дальнейшие исследования с этой точки зрения, Hainosankyuto может иметь выраженные противовоспалительные эффекты.

Мы попытались уточнить механизм этого защитного эффекта Хайносанкюто. Наши данные свидетельствуют о том, что предоставленная защита не была вызвана каким-либо прямым антибактериальным действием Хайносанкюто. Увеличение бактерицидной активности крови может помочь хозяину уничтожить бактерии в месте заражения, и в этом устранении важен врожденный иммунитет. Индуцированная IL-12 экспрессия IFN-γ обеспечивала защиту от инфекции S. pyogenes на мышиной модели за счет усиления врожденного иммунитета [13] , [14] , Подавление TNF-α также играет важную защитную роль при тяжелой инфекции S. pyogenes [15] , В группе, получавшей Hainosankyuto, была повышена не только бактерицидная активность крови, но и фагоцитарная активность перитонеальных макрофагов мышей. У мышей, обработанных хайносанкьюто, были обнаружены значительно более высокие уровни IL-12 и IFN-γ и значительно более низкий уровень TNF-α, чем у мышей без лечения. Взятые вместе, мы предположили, что индуцированная Hainosankyuto продукция цитокинов усиливает бактерицидную активность, включая фагоцитарную активность, которая, в свою очередь, вызывает уничтожение бактерий.

Кроме того, мы затем попытались уточнить, будет ли Hainosankyuto обеспечивать защиту, если он предоставляется только после бактериальной инфекции. Хотя мы не обнаружили значительного восстановления выживаемости при прямом введении Hainosankyuto только после заражения S. pyogenes , наши результаты показали, что размеры язвенного поражения были значительно меньше после введения Hainosankyuto по сравнению с введением PBS. Хайносанкюто может быть полезен для терапии локальных поражений после заражения S. pyogenes . Желательно дальнейшее клиническое исследование с участием людей о терапии S. pyogenes с использованием Hainosankyuto. Кроме того, имеет ли место аналогичный эффект при других бактериальных инфекциях, требует дальнейшего изучения.

Таким образом, Hainosankyuto был более эффективен в предотвращении инфекции S.pyogenes, чем при введении только после инфекции S. pyogenes . Мы предлагаем Hainosankyuto в качестве кандидата на новую терапию против S. pyogenes .

Материалы и методы

Бактериальные штаммы

S. pyogenes 1529 и D2TY были клиническими изолятами от тяжелой инвазивной болезни в Японии [16] , [17] , В частности, S. pyogenes D2TY имеет ген, устойчивый к макролидам, ermB . Свежую колонию инокулировали в течение ночи на кровяной агар (Nihon Becton Dickinson, Токио, Япония) и культивировали в течение 12 часов при 37 ° C. Бактерии собирали центрифугированием и ресуспендировали в стерильном PBS. Плотность бактерий определяли путем измерения поглощения при 660 нм (A660). Затем бактериальную суспензию разбавляли PBS до 109 КОЕ (колониеобразующая единица) / мл, используя стандартную кривую роста, чтобы связать измеренный А660 с концентрацией бактерий.

Соединение

Hainosankyuto был предоставлен как щедрый подарок от компании Tsumura Company Limited (Токио, Япония) ( Таблица 1 ) и его суспендируют в дистиллированной воде для приготовления исходного раствора в концентрации 0,1 г / мл.

Тестирование чувствительности

МИК Хайносанкюто была определена с использованием метода микроразведения в соответствии с рекомендациями Института клинических и лабораторных стандартов. [18] , MIC определяли как самую низкую концентрацию, не демонстрирующую видимого роста после 24 часов инкубации при 35 ° C по сравнению с контролем.

Мышиная модель инвазивной инфекции кожи и мягких тканей

Способность S. pyogenes вызывать локальные поражения кожи у мышей после подкожной инокуляции оценивали с использованием процедуры, описанной в другом месте. [19] , Вкратце, S. pyogenes собирали после 16-часового роста на агаре для инфузии сердца мозга (Eiken Chemical Co., Токио, Япония), содержащем 0,3% дрожжевого экстракта (BHY агар) с соответствующими антибиотиками, смешанными в 1 мл PBS, и затем центрифугировали при 2000 г в течение 2 мин. Осадки разводили в 100 мкл PBS до 1 × 108 КОЕ и затем инъецировали под поверхность кожи инбредных самок мышей Slc∶ICR 3-недельного возраста (Japan SLC, Inc., Сидзуока, Япония) с использованием иглы 25-го калибра. Количество вводимого КОЕ проверяли для каждого эксперимента путем высева бактерий на агаре BHY и подсчета КОЕ. Мышей наблюдали ежедневно на предмет образования очага и некроза. Размеры повреждения (длина × ширина) были измерены с длиной, определенной как самое длинное измерение повреждения. В группе, получавшей Hainosankyuto, мышей подвергали принудительному кормлению Hainosankyuto (0,1 мл / 10 г веса тела) в дни -1, 0, 1 и 2 после инокуляции S. pyogenes . Мышам в контрольной группе давали равный объем PBS и инфицировали тем же способом. Мы также выполнили другой протокол, чтобы прояснить влияние Hainosankyuto у животных, развивающих признаки. В группе, получавшей Hainosankyuto, мышей подвергали принудительному кормлению Hainosankyuto (0,1 мл / 10 г массы тела) в дни 1, 2, 3 и 4 после инокуляции S. pyogenes . Мы оценили смертность и размер некроза, используя те же методы, что и профилактический анализ.

Бактерицидный анализ крови

Бактерицидные анализы крови выполняли как оценку бактерицидного эффекта цельной крови с некоторой модификацией. [19] , В группе, получавшей Hainosankyuto, мышей подвергали принудительному кормлению Hainosankyuto (0,1 мл / 10 г массы тела) за 1 день до сбора. Мышам в контрольной группе давали равный объем PBS. Гепаринизированную кровь собирали у мышей, обработанных Hainosankyuto, и необработанных мышей, не зараженных S. pyogenes . Бактерицидные анализы крови выполняли следующим образом; приблизительно 1 000 КОЕ штамма добавляли к 1 мл цельной крови гепаринизированных мышей ICR. Образцы инкубировали при 37 ° С на вращателе. Аликвоты удаляли и высевали на агар BHY для определения количества КОЕ через 0, 30 и 60 мин. Данные выражали в виде количества бактериальных КОЕ каждый раз.

Анализ сывороточных цитокинов при заражении

Мы определили уровни сывороточных цитокинов, таких как IL-12, IFN-γ и TNF-α, в ходе инфекции у мышей, инфицированных S. pyogenes, получавших Hainosankyuto. Кровь как зараженных, так и обработанных / зараженных групп собирали под наркозом через 1 и 3 дня после заражения. Каждый образец крови центрифугировали, и полученную сыворотку хранили при -80 ° C до дня анализа. Уровни IL-12, IFN-γ и TNF-α определяли с помощью сэндвич-ELISA (Quantikine, R & D Systems Inc., MN, USA). Для анализа использовали комбинации захвата и биотинилированного mAb, как рекомендовано производителем. Уровни цитокинов рассчитывали, используя стандартные кривые мышиных рекомбинантных цитокинов, полученные на том же иммунопланшете.

Макрофагальные клетки

В группе, получавшей Hainosankyuto, мышей подвергали принудительному кормлению Hainosankyuto (0,1 мл / 10 г массы тела) за 1 день до перитонеального лаважа. Мышам в контрольной группе давали равный объем PBS. Клетки перитонеальных макрофагов мышей собирали с помощью лаважа с 6 мл холодного сбалансированного солевого раствора Хенкса (Wako pure химической промышленности, Осака, Япония) из брюшных полостей. Клетки дважды промывали и суспендировали в культуральной среде, получая 106 клеток / мл. Пятьсот мкл клеточной суспензии помещали в 1,5 мл пробирку и инкубировали в течение 2 часов при 37 ° С в 5% СО2. Культуральную среду осторожно удаляли аспирацией и заменяли свежей культуральной средой. Для клеточной культуры использовали RPMI-1640 (чистая химическая промышленность Wako) с добавлением 5% инактивированной фетальной бычьей сыворотки. Все клетки суспендировали в культуральной среде, высевали на 24-луночный культуральный планшет в дозе 6 × 105 клеток на лунку (конечный объем, 0,6 мл) и культивировали во влажной камере при 37 ° C с 5% CO2 и 95% воздуха. , 5-часовую культуру трижды промывали сбалансированным солевым раствором Хэнкса для удаления неадгезивных клеток, и только прилипшие клетки использовали в качестве культуры макрофагов.

Анализ макрофагов на фагоциты

Мышиный перитонеальный макрофаг смешивали с S. pyogenes и инкубировали в течение 1 часа при встряхивании при 37 ° С. Вкратце, анализы макрофагальных фагоцитов выполняли с использованием полипропиленовых пробирок, содержащих 100 мкл макрофага мыши (2 × 105 клеток) и 100 мкл S. pyogenes, чтобы получить конечную концентрацию 105 КОЕ / мл. S. pyogenes опсонизировали мышиной сывороткой в ​​течение 30 мин перед смешиванием. Образцы инкубировали при 37 ° С на ротаторе, аликвоты удаляли для количественного определения и высевали на агар BHY для определения количества КОЕ через 0, 30 и 60 мин. Данные выражали в виде количества бактериальных КОЕ каждый раз.

Нозерн-блоттинг анализ

Тотальную РНК экстрагировали с использованием набора для экстракции РНК QIAGEN (QIAGEN, Hilden, Germany) в соответствии с инструкциями производителя. Приблизительно пять мкг каждого препарата общей РНК подвергали электрофорезу в 1% агарозных гелях, содержащих 1,1 М формальдегид. РНК переносили на мембрану Hybond-N + (GE Healthcare, Waukesha, WI). Для ДНК-зондов использовались следующие праймеры: HPRT, 5'-GTTGGATACAGGCCAGACTTTGTTG-3 'и 5'-GAGGGTAGGCTGGCCTATAGGCT; IL12, ATGGCCATGTGGGAGCTGGAGAAAG и 5'-GTGGAGCAGCAGATGTGAGTGGCT-3 '; INF-γ, 5′-AACGCTACACACTGCATCT-3 ′ и 5′-TGCTCATTGTAATGCTTGG-3 ′; TNF-α, 5'-GTTCTATGGCCCAGACCCTCACA-3 ′ [20] , МРНК детектировали с помощью 32Р-меченых ДНК HPRT, IL12, INF-γ и TNF-α (набор для мечения ДНК случайным праймером, версия 2; Takara Bio Co. Ohtsu, Япония). Затем мембраны подвергали авторадиографии и анализировали при комнатной температуре с помощью анализатора биовизуализации (BAS-1800II; Fujifilm, Токио, Япония). Тройные анализы проводили с РНК по меньшей мере из трех независимых культур.

Количественная RT-PCR в явном времени

Пять мкг РНК подвергли обратной транскрипции с использованием системы синтеза первой нити SuperScript (Invitrogen Co., Карлсбад, Калифорния, США). Образцы кДНК затем подвергали ПЦР-анализу. Как было указано выше (секция анализа северного блоттинга). Для количественного определения РНК-анализа методом ПЦР в реальном времени используется система определения определения GeneAmp 7900 с зеленым реагентом SYBR (Life Technologies Corp., Карлсбад, Калифорния). Образцы подвергали 40 циклам амплификации, состоящим из 95 ° С в течение 15 с, а затем 60 ° С в течение 1 мин в соответствии с инструкциями изготовителя. Каждый анализ был нормирован на мРНК HPRT.

статистический анализ

Сравнение между группами в отношении бактерицидных и цитокиновых анализов крови проводилось с использованием t- критерия. Данные по выживаемости были оценены с помощью анализа выживаемости Каплана-Мейера и проверены на достоверность с использованием логарифмического критерия. Данные о размере повреждения также были проверены на значимость с использованием непарного двустороннего t- критерия. Р <0,05 считали значимым.

Подтверждения

Мы благодарим д-ра Ичиро Тацуно, д-ра Масанори Исака и г-на Хидеюки Мацуи за их поддержку на протяжении всего расследования.

Вклад автора

Проанализированы данные: ММ МИ НХ ТН. Задумал исследование: ММ. Разработал и выполнил экспериментальную работу: ММ МИ НХ ТН. Написал оригинальную рукопись: ММ. Помог в разработке окончательной рукописи: МИ НХ ТХ. Утверждена итоговая рукопись: ММ МИ НХ ТН.

Рекомендации

  1. 1. Каннингем М.В. (2000). Патогенез стрептококковой инфекции группы А. Clin Microbiol Rev 13: 470–511.
  2. 2. Brook I (2001). Неспособность пенициллина уничтожить бета-гемолитический тонзиллит стрептококка группы A: причины и лечение. J Otolaryngol 30: 324–329.
  3. 3. Рихтер С.С., Хейлманн К.П., Бикман С.Э., Миллер Н.Дж., Миллер А.Л. и др. (2005) Устойчивый к макролидам Streptococcus pyogenes в США, 2002–2003. Clin Infect Dis 41: 599–608.
  4. 4. Иших А., Нагата Т., Миясе Т., Охори К., Терада М. (2007) Защитные эффекты лекарственного средства Kampo, Hochu-ekki-to (TJ-41) на летальную малярийную инфекцию с помощью Plasmodium chabaudi AS у мышей A / J. J Nat Med 61: 280–287.
  5. 5. Симидзу С., Фуруно Х., Хоригучи А., Ван Х., Огата Й. (1997) Создание модели мыши для сальмонеллезной инфекции и испытание иммуномодулирующей терапии с использованием Hochu-ekki-to. Jpn J Orient Med 48: 369–376.
  6. 6. Kuo CF, Chen CC, Luo YH, Huang RY, Chuang WJ и др. (2005) Мицелий Cordyceps sinensis защищает мышей от стрептококковой инфекции группы А. J Med Microbiol 54: 795–802.
  7. 7. Ozaki Y. (1995) Исследования противовоспалительного эффекта японских восточных лекарств, используемых для лечения воспалительных заболеваний. Biol Pharm Bull 18: 559–562.
  8. 8. Чунг Дж.В., Нох Э.Дж., Чжао Х.Л., Сим Дж.С., Ха Й.Х. и др. (2008) Противовоспалительная активность просапогенинового метилового эфира платикодина D посредством ингибирования пути ядерного фактора-каппа B. Biol Pharm Bul 31: 2114–2120.
  9. 9. Kroes BH, Beukelman CJ, van den Berg AJ, Wolbink GJ, van Dijk H, et al. (1997) Ингибирование человеческого комплемента бета-глицирретиновой кислотой. Иммунология 90: 115–120.
  10. 10. Балтина Л.А. (2003) Химическая модификация глицирризиновой кислоты как путь к новому биологически активному соединению для медицины. Curr Med Chem 10: 155–171.
  11. 11. Дай Й., Но ППХ, Чан Ю.П., Мацуда Х., Кубо М. (2002) Противозудное и противовоспалительное действие водного экстракта из Си-Ву-Танг. Biol Pharm Bull 25: 1175–1178.
  12. 12. Shimizu H., Tsuchiya K, Sakurai H. (1990) Супероксиддисмутазоподобная активность Kampo-составов, обладающих анальгетическими и противовоспалительными свойствами. J Trad Med 7: 54–60.
  13. 13. Метцгер Д.В., Редер Р., Ван Клив В.Х., Бойл М.Д. (1995). Защита мышей от стрептококковой инфекции кожи группы А интерлейкином-12. J Infect Dis 171: 1643–1645.
  14. 14. Редер Р.Х., Баркер-Меррилл Л., Лестер Т., Бойл М.Д.П., Метцгер Д.В. (2000). Основная роль интерферона g в защите от стрептококковой инфекции кожи группы А. J Infect Dis 181: 639–645.
  15. 15. Diao H, Kohanawa M (2005). Эндогенный интерлейкин-6 играет важную защитную роль при синдроме стрептококкового токсического шока посредством подавления продукции фактора некроза опухоли альфа. Infect Immun 73: 3745–3748.
  16. 16. Танака М., Хасегава Т., Окамото А., Тории К., Охта М. (2005). Влияние антибиотиков на выработку экзопротеинов стрептококка группы А, анализируемое с помощью двумерного гель-электрофореза. Антимикробные агенты Chemother 49: 88–96.
  17. 17. Минами М, Камимура Т, Исака М, Тацуно I, Охта М и др. (2010) Клиндамицин-индуцированная CovS-опосредованная регуляция продукции вирулентных экзопротеинов: стрептолизин О, НАД-гликогидролаза и стрептокиназа в Streptococcus pyogenes . Антимикробные агенты Chemother 54: 98–102.
  18. 18. CLSI / NCCLS (2003) Метод разведения теста на антимикробную восприимчивость к бактериям, которые растут аэробно. Утвержден стандарт М7-А6, 6-е изд. CLSI / NCCLS, Уэйн, PA.Metzger DW
  19. 19. Hasegawa T, Minami M, Okamoto A, Tatsuno I, Isaka M, et al. (2010) Характеристика ассоциированной с вирулентностью и расположенной на клеточной стенке ДНКазы Streptococcus pyogenes . Микробиология 156: 184–190.
  20. 20. Peng X, Mosser DM, Adler MW, Rogers TJ, Meissler JJ Jr и др. (2000) Морфин усиливает интерлейкин-12 и выработку других провоспалительных цитокинов в перитонеальных макрофагах мыши. J лейкоцитарная биология 68: 723–728.

Похожие

Как интерпретировать результаты анализов крови?
... анализа крови для непосвященных - черная магия. И фундаментальные исследования должны проводиться как минимум раз в год. Как их прочитать и о чем свидетельствуют неверные значения? Анализ крови является наиболее важным из всех анализов. Оценка показателей крови позволяет определить состояние здоровья
Анализ мочи - Анализ мочи
... при диагностике почек и других органов. Анализ мочи, так же, как морфология Это стоит делать хотя бы раз в год, чтобы оценить свое общее состояние здоровья. Анализ мочи - что это? Тест состоит из оценки физических характеристик (цвет, прозрачность, запах, pH, удельный вес (относительная плотность), химических характеристик ( глюкоза ,
Новый аденовирус у летучих мышей, Германия
Emerg Infect Dis. 2009 дек; 15 (12): 2052–2055. Институт Роберта Коха, Берлин, Германия (М. Соннтаг, А. Курт) Институт исследований зоопарка и дикой природы им. Лейбница, Берлин (К. Мюльдорфер, С. Спек. Г. Виббелт) Адрес для переписки: Андреас Курт, Центр биологической безопасности 1, Институт Роберта Коха, Берлин, Германия; Эл. адрес: [email protected] Эта статья была
Фруктовые мухи - эффективные методы борьбы
Летом просто оставьте незрелые фрукты на кухонном столе или несколько яблочных шкур в корзине, и уже станьте квартирой для незваных гостей в нашем доме. Плодовые мухи - очень мелкие насекомые, растущие до 2–3 миллиметров, принадлежащие к двукрылым, очень распространенным в нашей стране. В целях потребления они выбирают только перезревшие фрукты, на которых начали размножаться дрожжи, что привлекает их так много. Соблазняют их и другие продукты, поэтому от них так сложно избавиться раз и навсегда.
Низкоэнергетический импульсный свет для удаления волос в домашних условиях
... наук, Gold Care Center, Suite 220, Нэшвилл, TN 37215; Телефон: 615-383-2400; Факс: 615-385-0387; Эл. адрес: [email protected] РАСКРЫТИЕ ИНФОРМАЦИИ: Доктор Голд провел исследование и выступает от имени Home Skinovations. Г-жа Фостер и г-жа Бирон не сообщают о соответствующих конфликтах интересов. Эта статья была цитируется другие
Лазерная эпиляция безопасна?
Лазерная эпиляция - это безопасный и эффективный способ навсегда уменьшить или удалить лишние волосы со всех участков тела. Хотя это, конечно, очень безопасный метод удаления волос, лазерное лечение имеет много мер предосторожности, которые необходимо соблюдать при подготовке к сеансам удаления волос. Основным фактором риска при прохождении лазерного лечения является гарантия того, что ваша кожа не будет повреждена лазером во время курса лечения. Реакции кожи
Методы мужской контрацепции в развитых странах?
600 тысяч вазэктомия в год в США, 7 миллионов в Китае! 1,2 миллиона сальпинготомий в США. 1000 вазэктомии в Польше! Год?! Трудно получить точное количество вазэктомии, сделанной в США, потому что многие процедуры проводятся в частных клиниках.
Домашние методы лечения цистита
Обновление 18 февраля 2019 Воспаление мочевого пузыря в основном относится к женским недугам, обусловленным его анатомическим строением. К счастью, есть много способов избавиться от этой проблемы. Сегодня мы представляем несколько домашних решений для
Естественные методы контрацепции - температурный метод (термический)
Основой этого метода является прогнозирование времени овуляции на основе измерения базовой температуры тела. Как известно, гипоталамо-гипофизарная система, помимо регулирования функционирования яичников, регулирует
Ультразвуковая визуализация и анализы крови могут выявить рак печени на ранних стадиях
... наружили, что объединение ультразвуковых изображений с анализами крови, которые проверяют уровень альфа-фетопротеина (AFP), может улучшить обнаружение рака печени на ранней стадии на 40%. Имеется около 42 220 новых диагнозов рака печени, и около 30 200 из них умирают в год. Он затрагивает больше мужчин, чем женщин, и его распространенность более чем утроилась с 1980 года. Американское онкологическое
Звездный путь Металл Земля Наборы Модель
Металлические модели некоторых из самых любимых кораблей Star Trek Два предприятия и два клингона Не требуется клей Когда мы приблизились к аномалии, начали происходить странные вещи. Луч неопознанной энергии ударил корабль. Оно не проникало в корпус, казалось, только сканировало поверхность. И не только нам, но и всем близлежащим кораблям, в том числе нескольким клингонским. На мгновение все было тихо после луча энергии. И тогда репликаторы начали

Комментарии

Какие методы являются наиболее эффективными: бабушкины методы или, возможно, новые, только что известные?
Какие методы являются наиболее эффективными: бабушкины методы или, возможно, новые, только что известные? Откуда взялись эти болячки у детей? Младенцы и маленькие дети находятся в опасности
Что такое морфология крови?
Что такое морфология крови? Кровь представляет собой суспензию эритроцитов (эритроцитов), лейкоцитов (лейкоцитов) и тромбоцитов в плазме. Морфология крови - популярное, очень часто проводимое исследование, основанное на их количественном и качественном анализе. Как проводится анализ крови и как к нему подготовиться? Пять мл крови взяты из вены в специальные пробирки, содержащие ЭДТА (вещество, предотвращающее свертывание крови). Перед тестом пациент не должен заниматься
Каковы их результаты?
Каковы их результаты? Все это необходимо для ответа на Ваш вопрос.
Сколько времени мы загружаем пакет?
Сколько времени мы загружаем пакет? Пакет с емкостью 2000 мАч Зарядное устройство с зарядным током 400 мАч 2000/400 = 5 часов Поэтому процесс зарядки для этого пакета будет длиться 5 часов, но если вы подключите пакет на 4000 мАч, время зарядки будет увеличено до 10 часов. Мы также никогда не знаем, полностью ли завершен процесс. По этой причине такие зарядные устройства обычно подходят для запуска, чтобы вообще начать модельное приключение.
Льготный период в страховании: сколько времени это займет и что для этого нужно?
Льготный период в страховании: сколько времени это займет и что для этого нужно? Различные страховщики используют разные льготные периоды, в зависимости от типа гарантированных льгот. Например, для одного страховщика льготный период в случае серьезного заболевания составит 3 месяца, а в другом - 6. Поэтому, прежде чем принимать решение о конкретной политике, стоит обратить особое внимание на положение в GTC, в котором говорится о льготном периоде. Помните, однако, что
Вы когда-нибудь рисковали потерять любимого человека, важные отношения с другими людьми, работу, учебу или карьеру в связи с проведением слишком много времени в Интернете?
Вы когда-нибудь рисковали потерять любимого человека, важные отношения с другими людьми, работу, учебу или карьеру в связи с проведением слишком много времени в Интернете? Вы когда-нибудь лгали своим родственникам, терапевтам или кому-то еще, чтобы скрыть ваш чрезмерный интерес к Интернету? Используете ли вы Интернет, чтобы избежать проблем или избежать неприятных ощущений (например, чувства беспомощности, вины, тревоги или
Но одинакова ли инсулинорезистентность этих тканей?
Но одинакова ли инсулинорезистентность этих тканей? В 1999 году эксперименты обнаружили, что это было не то же самое. Обычно концентрация инсулина в крови не более 10 мкл / мл достаточна для подавления распада жира на 50% в жировой ткани. Для достижения 50% высвобождения глюкозы в кровь печени необходимо 30 мкг / мл инсулина. И чтобы увеличить поглощение глюкозы мышечной тканью на 50%, требуется концентрация инсулина 100 мкг / мл или более. Напомним, что липолиз - это
Каковы основные симптомы заболевания?
Каковы основные симптомы заболевания? Ревматическая лихорадка обычно характеризуется набором симптомов, которые могут быть разными у каждого пациента. Затем следует стрептококковая ангина или тонзиллит с необработанными антибиотиками. Воспаление горла или тонзиллит можно диагностировать с помощью лихорадки, ангины, головной боли, покраснения неба и миндалин с присутствующим гнойным секретом и увеличенными и болезненными лимфатическими узлами шеи. Однако эти симптомы могут быть очень
Лучший способ обеспечить безопасное и эффективное лечение для вашего типа кожи?
Лучший способ обеспечить безопасное и эффективное лечение для вашего типа кожи? Проконсультируйтесь с поставщиком, который имеет обширную подготовку и знания в области лазерной шлифовки и опыт работы с пациентами с темной кожей. 4. Кто выполняет процедуру лазерной шлифовки, оказывает огромное влияние на ваши результаты В руках высококвалифицированного, знающего профессионала лазерная шлифовка является безопасным способом значительно улучшить внешний вид вашей кожи.
Например, многие молодые женщины могут задать один вопрос: каков оптимальный возраст для того, чтобы стать новой матерью, если вы хотите минимизировать влияние рождения ребенка на ваш заработок?
Например, многие молодые женщины могут задать один вопрос: каков оптимальный возраст для того, чтобы стать новой матерью, если вы хотите минимизировать влияние рождения ребенка на ваш заработок? Ответ из литературы ... это зависит. Вы пытаетесь максимизировать свой заработок на всю жизнь или сократить разрыв в оплате с вашим супругом? В зависимости от ваших целей, исследование может привести вас к совершенно другим выводам. Один
Имеет ли правовая форма союза какое-либо значение, когда речь идет о восприятии партнерами совместных финансов?
Имеет ли правовая форма союза какое-либо значение, когда речь идет о восприятии партнерами совместных финансов? Согласно отчету Maison & Partners по заказу Wonga, брак меняет наш взгляд на общие деньги. Партнеры по официальным отношениям более склонны вести совместное финансирование и охотнее помогать в случае проблем другой половины.

Как их прочитать и о чем свидетельствуют неверные значения?
Анализ мочи - что это?
Год?
Какие методы являются наиболее эффективными: бабушкины методы или, возможно, новые, только что известные?
Откуда взялись эти болячки у детей?
Что такое морфология крови?
Как проводится анализ крови и как к нему подготовиться?
Каковы их результаты?
Сколько времени мы загружаем пакет?
Сколько времени мы загружаем пакет?